Identification of the Mitochondrial ND1 Gene Carrier of Diabetes Mellitus Type 2 with Blood Samples
Identifikasi Gen ND1 Mitokondria Pembawa Sifat Diabetes Mellitus Tipe 2 Melalui Sampel Darah
-
(1) * Hindah Sabrina Amin
Universitas Muhammadiyah Sidoarjo
Indonesia
(2) Miftahul Mushlih Universitas Muhammadiyah Sidoarjo
Indonesia
(*) Corresponding Author
Abstract
Diabetes Mellitus is a condition where there is an increase in blood glucose levels which is characterized by impaired insulin production or the inability of target tissues to respond to insulin. The purpose of this study was to determine the characteristics of the NADH Dehydrogenase 1 gene in the family of Type 2 Diabetes Mellitus patients. The study used a descriptive exploratory method. The sample came from a family of 5 people with T2D in Sidoarjo. Mitochondrial Genotype Analysis using PCR-Primary Sequencing Forward 5'GAGCAGAACCCAACCTCCGAGCAG3 '(nt2826–2849) and Primary Rivers 5'GATTGTTTGGGCTACTGCTCG3' (nt3728 - 3749). Analysis of the 5 samples used obtained 2 samples that can be analyzed with a band length of 690 bp and 84 bp. Based on the results of primary research, the sample used is difficult to get good amplification results. Only one out of five samples can be amplified properly. The variation of the amplified ND1 gene is found at positions T3031C, G3143C, A3252G, C3303T, C3707T.
References
Alexandar, S. P., Dhinakaran, I., Ravi, V., Parthasarathy, N., Ganesan, S., Bhaskaran, M., & Arun Kumar, G. P. (2017). Meta-Analysis of Association of Mitochondrial DNA Mutations with Type 2 Diabetes and Gestational Diabetes Mellitus. International Journal of Human Genetics, 17(4), 177–190. doi: 10.1080/09723757.2018.1430110 DOI: https://doi.org/10.1080/09723757.2018.1430110
Anani, L. (2008). Prevalence of 15 Mitochondrial DNA Mutations Among Type 2 Diabetic Patients with or without Clinical Characteristics of. 1228–1235. DOI: https://doi.org/10.1590/S0004-27302008000800005
Andersson, D. K., & Petersson, C. (2004). Screening for Type 2 Diabetes. Diabetes Care, 27 (Suppl 1), S11-14. doi: 10.2337/diacare.27.2007.S11 DOI: https://doi.org/10.2337/diacare.27.2007.S11
Asif, M. (2014). The prevention and control the type-2 diabetes by changing lifestyle and dietary pattern. Journal of Education and Health Promotion, 3(1), 1. doi: 10.4103/2277-9531.127541 DOI: https://doi.org/10.4103/2277-9531.127541
Ishak, A. R., Puspitaningrum, R., Utari, R. D., Feranita, M., Adhiyanto, C., Nitta, T., Susanto, A. B., Yukio, H., & Yamashiro, Y. (2014). Mutation of mtDNA ND1 Gene in 20 Type 2 Diabetes Mellitus Patients of Gorontalonese and Javanese Ethnicity. HAYATI Journal of Biosciences, 21(4), 159–165. doi: 10.4308/hjb.21.4.159 DOI: https://doi.org/10.4308/hjb.21.4.159
Lyssenko, V., & Laasko, M. (2013). Genetic Screening for the Risk of Type 2 Diabetes. Diabetes Care, 36, 120–126. doi: 10.2337/dcS13-2009 DOI: https://doi.org/10.2337/dcS13-2009
Majamaa, K., Moilanen, J. S., Uimonen, S., Remes, A. M., Salmela, P. I., Kärppä, M., Majamaa-Voltti, K. A. M., Rusanen, H., Sorri, M., Peuhkurinen, K. J., & Hassinen, I. E. (1998). Epidemiology of A3243G, the mutation for mitochondrial encephalomyopathy, lactic acidosis, and strokelike episodes: Prevalence of the mutation in an adult population. American Journal of Human Genetics, 63(2), 447–454. doi: 10.1086/301959 DOI: https://doi.org/10.1086/301959
Maksum, I. P., Sriwidodo, Suprijana, O., Natadisastra, G., Nuswantara, S., & Noer, A. S. (2010). Identification of the a3243G Heteroplasmy Mutation and Study of Maternal Inheritance in the Type-2 Diabetes Mellitus Patients. Bionatura-Jurnal Ilmu-Ilmu Hayati Dan Fisik, 12(2), 78–85.
Santoso dan Santi, (2016). Biologi Molekular Sel. Jakarta : Salemba Tanika
Satiyarti, R. B., Nurmilah, N., & Rosahdi, T. D. (2017). Identifikasi Fragmen Dna Mitokondria Pada Satu Garis Keturunan Ibu Dari Sel Epitel Rongga Mulut Dan Sel Folikel Akar Rambut. Biosfer: Jurnal Tadris Biologi, 8(1), 13–27. doi: 10.24042/biosf.v8i1.1260 DOI: https://doi.org/10.24042/biosf.v8i1.1260
Sriwidodo, Suprijana, O., Subroto, T., & Maksum, I. P. (2008). Studi Mutasi Titik a3243G Dna Mitokondria Penyebab Maternally. Pharmaceutical Sciences and Research, V(3), 121–129.
Surudarma, I. W., Wihandani, D. M., & Dwipayana, I. M. P. (2015). Identifikasi Mutasi Heteroplasmi A3243G mtDNA dengan Metode PCR Allele ’ s Specific Amplification ( PASA ) pada Penderita Diabetes Melitus Tipe 2 Suku Bali. 1–22. Retrieved from https://repositori.unud.ac.id/protected/storage/upload/penelitianSimdos/e37b7180ab0cb37cda0c013c6c159740.pdf
Tang, D. L., Zhou, X., Li, X., Zhao, L., & Liu, F. (2006). Variation of mitochondrial gene and the association with type 2 diabetes mellitus in a Chinese population. Diabetes research and clinical practice, 73(1), 77–82. doi: 10.1016/j.diabres.2005.12.001 DOI: https://doi.org/10.1016/j.diabres.2005.12.001
